liyah2cute16 liyah2cute16

22-12-2021
Biology

contestada

1. A molecule that contains only carbon and hydrogen is called a
-
carbohydrate
carbonyl
hydrocarbon
hydroxyl

Respuesta :

Eddie1Wan Eddie1Wan

22-12-2021

Answer:

hydrocarbon

Explanation:

It's called a hydrocarbon

Answer Link

Otras preguntas

Anna and Sam each want to run for president of their school's student body council. In order to do so, they must collect a certain number of signatures and get

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Solve for m. m+13<−214 m>−11112 m>−2712 m<−11112 m<−2712

The average level of glucose (also known as blood sugar in a person) is 85 mg/100 mL of blood. If the person has 5.1liters of blood, how many milligrams of gluc

How does your body respond to a decrease in blood glucose

Explain what happens to water during electrolysis. Is this a chemical reaction or phase change?

evaluate the following division: (3b-6a)÷(30a-15b)

A force of 18 lb is required to hold a spring stretched 2 in. beyond its natural length. How much work W W is done in stretching it from its natural length to 7

write an equation that represents the data in the table: x - 5, 10, 15, 20 y - 17, 22, 27, 32

line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form