adibap20
adibap20 adibap20
  • 21-10-2021
  • Mathematics
contestada

guys pls help me!!!!!!

guys pls help me class=

Respuesta :

guineapiggirl3806 guineapiggirl3806
  • 21-10-2021

Answer: 100

Step-by-step explanation:

A line equals 180 so subtract 180-80 to get your answer.

Answer Link

Otras preguntas

write a letter to the editor to complain about the bad road conditions in your area​
Determine the angle A in the picture below: A B C D
A sample of ammonia reacts with oxygen as shown. 4NH3(g) 5O2(g) Right arrow. 4NO(g) 6H2O(g) What is the limiting reactant if 4. 0 g of NH3 react with 8. 0 g of
What is the perimeter of this triangle rounded to the nearest tenth of a unit? A.32.0 B.34.0 C37.5 D.40.4
15 is what percentage of 175? (Answer will include 2 places to the right of the decimal)
Determine the length of AB to the nearest tenth of a metre. pls help!!
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
I need help like asap got sm work to do THIS WILL BE MARKED BRANNLOEST
Describe the steps you would take to prepare yourself for a new job.
What is the area of this figure? Part 8. NO LINKS!!​