tyreyannajohnso1 tyreyannajohnso1

22-05-2020
Mathematics

contestada

Find the difference. Express your answer in lowest terms.
22 1/3 - 6 3/4

Respuesta :

sarahbailey27 sarahbailey27

22-05-2020

Answer:

15 7/12

Step-by-step explanation:

Answer Link

Otras preguntas

A force of 18 lb is required to hold a spring stretched 2 in. beyond its natural length. How much work W W is done in stretching it from its natural length to 7

Explain with examples of your own how to find the domain and range of a function.

Crystal has negative moods, is mostly inactive, and is slow to adapt to new situations. When confronted with a new situation, she tends to withdraw. Crystal is

HELP PLEASEEEEEEEEEEEEE

The Texas budget includes over 200 dedicated funds to support specific public policy areas. Plus, billions of federal dollars sent to Texas must be used for spe

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

what was the significance of the fighting at lexington and concord in 1775?

the geographical and financial importance of Mewar, Gujarat, Bengal, Kandhar, Bulk, Badakhshan, Golconda

A 7-year, $1,000 par bond has an 8% annual coupon and is currently yielding 7.5%. The bond can be called in 3 years at a call price of $1,010. What is the bond

relation between population environment and development?