2021pooleAR 2021pooleAR

26-08-2016
Mathematics

contestada

turn this into a exponent
c x 1/4 x c x 1/4 x 1/4

Respuesta :

dalendrk dalendrk

26-08-2016

[tex]c\times\dfrac{1}{4}\times c\times\dfrac{1}{4}\times\dfrac{1}{4}=\left(\dfrac{1}{4}\right)^3c^2[/tex]

Answer Link

Otras preguntas

what is 9/blank= 4? i really don't know

True or False. Narratives do not need to be revised or edited.

¿Qué es lo más importante que necesitas cuando viajas a un país diferente? O pasaporte O maleta o boleto O viajar

How did disease affect the civil war troops?

Read the topic sentence from asher's analysis of enrique's journey. To demonstrate enrique's intelligence and resourcefulness, nazario depicts his response to t

Appeals to a desire for safety and self-actualization are examples of ___________. A. Logical appeals b. Emotional appeals c. Credibility appeals d. Selective a

if f(x)=-x+2 find f(6)

Please help i think this is sort of easy but i don't understand it at all giving you 100 points(Review the lesson Evaluating Online Resources. Then do an online

when did the European slave trade out of Africa arise and expand a. when the west coast of Africa was conquered by the Europeans. b. when gold was discovered i

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):