capandre272 capandre272

26-04-2024
Mathematics

contestada

It is given that (2³²⁺¹) is exactly divisible by a certain number. Which of the following is also definitely divisible by the same number?

Respuesta :

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

Hari had 6 siblings who were born all born 2 years apart. The youngest is Richa who is only 7 years old while Hari is the oldest. What is Hari's age?

how did George HW Bush attract voters during his presidential campaign in 1992?

can i get your help please Simplify: 176/14

Wich European countries conquered and settled most of North and South America in the 1500 and 1600’s

What is the most likely reason why the author includes these passages

ASL When obtaining clarification of a signed message, you can .... A. Sign "slow" B. Sign “again C. Repeat the sign given D. All of the above

solve 3x2- 2x -7 = 0

What was required for an adult male to become a citizen of Rome? *

5.x2 and 5x ? What’s the answer