tylarwebb6157 tylarwebb6157

26-04-2024
Computers and Technology

contestada

Which three actions can be applied on the messages before they are released due to overflow?
A) Retention
B) Encryption
C) Compression
D) Fragmentation

Respuesta :

Otras preguntas

Which decimal is equal to 42 ? 10 A. 0.04 B. 0.4 O c. 0.41 O D. 4.10

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

________ are the most commonly used species for animal research.

Plis you chancel me pliss

When your hear the word empire, what comes in your mind?

Every day, Jackie practices basketball and guitar. Each day, she practices basketball for 1.5 hours. If after 6 days she practiced both basketball and guitar fo

Determine tho value of x in the figure. А) х= 6 B) x=9 C)x= 4.5 D) x =3

a car takes 10 mins to go from A to B, 10km away, it stops for 10 mins to have a flat tyre changed. it then goes from B to C, a further 15km, in yet to another

Will mark brainliest!

Transaction data for Crane Real Estate Agency are presented as follows. Oct. 1 James Crane begins business as a real estate agent with a cash investment of $22