kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

The figure below is made of two identical triangular prisms. What is the volume of the figure?

PLEASE HELP WILL MARK BRAINLIEST Find the area of the figure. (Sides meet at right angles.)

Which of the following are dependent events?O A. Flipping a coin and getting tails, and then flipping it again andgetting tails againO B. Rolling a die and gett

What is the best definition of the term "cotton industry"

Which is a frame shift mutation

find the value of x when m<2= x + 64

Find the area of the triangle Need help fast

Rectangle ABCD is rotated 180°. What rule shows the input and output of the rotation, and what is the new coordinate of A′?

A new lawn has a perimeter of 278ft. And a width of 64ft. A bag of grass seed will cover 384ft of ground. How many bags of grass seed are needed to seed the new

Please answer this correctly